Cosmetic cross-reference
Noindex: medium evidence
Platinum
CAS 7440-06-4
Platinum (CAS 7440-06-4) is a pharmaceutical compound with 0 bioactivity targets and 33 adverse event associations.
SOURCE
NLM DailyMed
Label records
0
SOURCE
EMBL-EBI ChEMBL
Bioactivity
0
SOURCE
DrugCentral / FAERS
Adverse signals
33
SOURCE
IUPHAR / PharmGKB
PubMed IDs
14
SOURCE
EPA DSSTox
Compound Identity
Matched identifiers and naming fields for the pharmaceutical compound record.
Primary Name
Platinum
CAS Number
7440-06-4
Molecular Formula
Pt
InChIKey
BASFCYQUMIYNBI-UHFFFAOYSA-N
Source Match
EPA DSSTox
SOURCE
Ingredients table / CosIng profile
same-CAS cross-reference
Cross-Reference to Cosmetics
Same-CAS ingredient record found in the cosmetics vertical.
SOURCE
DSSTox identifiers
DTXSID9064681
Cross-Reference to Chemicals
Same-CAS substance identity is available in the industrial chemicals vertical.
Platinum is linked to DTXSID9064681 in DSSTox identifiers.
View industrial chemical data →
SOURCE
PharmGKB drug-gene phenotypes
56 phenotype rows
Pharmacogenomics
Drug-gene phenotype annotations and evidence levels from PharmGKB-mapped rows.
C18orf56 (PA134956204),"TYMS (PA359)" rs45445694
Genotypes (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 + (CCGCGCCACTTGGCCTGCCTCCGTCCCG)3/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)3 is associated with decreased progression-free survival when treated with capecitabine and platinum in people with Colorectal Neoplasms or gastroesophageal cancer as compared to genotype (CCGCGCCACTTGGCCTGCCTCCGTCCCG)2/(CCGCGCCACTTGGCCTGCCTCCGTCCCG)2.
Evidence: -; PMID 25677447
ABCB1 (PA267) rs2032582
Genotype CC is associated with decreased risk of grade 3 or 4 gastrointestinal toxicity when treated with platinum and taxanes in people with Ovarian Neoplasms.
Evidence: -; PMID 19203783
ERCC1 (PA155) rs11615
Genotypes AG + GG are associated with increased likelihood of response when treated with platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype AA.
Evidence: -; PMID 19362955
XRCC1 (PA369) rs25487
Genotype TT is associated with worse overall survival outcome when treated with platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype CC.
Evidence: -; PMID 19362955
ERCC1 (PA155) rs3212986
Genotypes AA + AC are associated with increased overall survival when treated with platinum in people with Carcinoma, Non-Small-Cell Lung as compared to allele C.
Evidence: -; PMID 19362955
ERCC5 (PA27851) rs17655
Genotype GG is associated with decreased survival when treated with platinum in women with Ovarian Neoplasms as compared to genotypes CC + CG.
Evidence: -; PMID 22158331
ERCC5 (PA27851) rs17655
Genotype GG is associated with increased survival when treated with platinum in women with Ovarian Neoplasms as compared to genotypes CC + CG.
Evidence: -; PMID 22158331
POU2F2 (PA33537) rs195862
Allele C is not associated with response to platinum in people with Lung Neoplasms as compared to allele A.
Evidence: -; PMID 24643204
POU2F2 (PA33537) rs2444933
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
POU2F2 (PA33537) rs3823036
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
POU2F2 (PA33537) rs195854
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele A.
Evidence: -; PMID 24643204
AQP2 (PA24920) rs3759125
Allele A is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
AQP2 (PA24920) rs10875989
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
AQP9 (PA24927) rs1867380
Allele A is not associated with response to platinum in people with Lung Neoplasms as compared to allele G.
Evidence: -; PMID 24643204
TMEM205 (PA162406385) rs7251786
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
TMEM205 (PA162406385) rs896412
Allele G is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
LRP1 (PA233) rs1057451
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele G.
Evidence: -; PMID 24643204
LRP1 (PA233) rs4788186
Allele A is not associated with response to platinum in people with Lung Neoplasms as compared to allele G.
Evidence: -; PMID 24643204
LRP1 (PA233) rs7204252
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
LRP1 (PA233) rs4788184
Allele T is not associated with response to platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 24643204
RICTOR (PA165660455) rs7719775
Genotype AA is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype GG.
Evidence: -; PMID 27676404
RICTOR (PA165660455) rs7703002
Genotype AA is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype CC.
Evidence: -; PMID 27676404
AQP9 (PA24927) rs1516400
Allele A is not associated with response to platinum in people with Lung Neoplasms as compared to allele G.
Evidence: -; PMID 24643204
AQP9 (PA24927) rs1554203
Allele A is not associated with response to platinum in people with Lung Neoplasms as compared to allele G.
Evidence: -; PMID 24643204
RICTOR (PA165660455) rs6878291
Genotype GG is associated with decreased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype AA.
Evidence: -; PMID 27676404
ERCC5 (PA27851) rs17655
Genotype GG is associated with increased response to platinum in people with Carcinoma, Non-Small-Cell Lung as compared to genotype CC.
Evidence: -; PMID 28314991
AQP2 (PA24920) rs10875989
Allele T is associated with increased severity of Anemia, Leukopenia, Neutropenia and Thrombocytopenia when treated with platinum in people with Lung Neoplasms as compared to allele C.
Evidence: -; PMID 26358256
XRCC5 (PA37425) rs1051685
Allele G is associated with decreased severity of Anemia, Leukopenia, Neutropenia and Thrombocytopenia when treated with platinum in people with Lung Neoplasms as compared to allele A.
Evidence: -; PMID 26358256
AQP2 (PA24920) rs3759125
Genotypes AA + AC is associated with increased severity of Anemia, Leukopenia, Neutropenia and Thrombocytopenia when treated with platinum in people with Lung Neoplasms as compared to genotype CC.
Evidence: -; PMID 26358256
AQP2 (PA24920) rs7305534
Genotypes CC + CT is associated with increased severity of Diarrhea, Nausea and Vomiting when treated with platinum in people with Lung Neoplasms as compared to genotype TT.
Evidence: -; PMID 26358256
SOURCE
Rendered pharma page rows
FAQPage JSON-LD
Frequently Asked Questions
Short answers generated only from the same visible source-linked rows on this page.
What is Platinum used for in pharmaceutical contexts?
Platinum (CAS 7440-06-4) is rendered as a pharmaceutical compound from the matched source rows; no DailyMed product-name rows are present in this page query.
What are the known adverse events for Platinum?
Platinum has 33 DrugCentral/FAERS adverse event associations. Rendered reaction terms include Adrenal insufficiency, Adverse event, Alanine aminotransferase increased, Anaemia, Aspartate aminotransferase increased. Signal rows are source-linked records and should not be read as incidence rates or causality conclusions.
Is Platinum also used in cosmetics?
Yes. The ingredients table has a same-CAS cosmetic profile for Platinum with EU status "restricted".
What clinical phase is Platinum in?
No phase 1-4 clinical development badge is rendered for Platinum because the matched compound identifier rows do not contain a max-phase value.